Livestock Research for Rural Development 21 (8) 2009 Guide for preparation of papers LRRD News

Citation of this paper

Growth hormone gene polymorphism and its association with egg production in Kadaknath chicken

M S Thakur, S N S Parmar, M V Chaudhari and J K Bhardwaj

Department of Animal Breeding and Genetics, College of Veterinary Science and Animal Husbandry, Jabalpur. Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur, Madhya Pradesh-482001, India
drmohansingh@gmail.com

Abstract

The growth hormone gene polymorphism was conducted using PCR-RFLP method. The RFLP pattern of cGH1 (770 bp) revealed restriction fragment of 529, 373, 241 and 156 bp size, which indicates two restriction sites. The RFLP pattern of cGH2 (1216 bp) revealed restriction fragment of 1216 and 608 bp size, which indicates only one restriction site. The genotype frequency for cGH1 (770 bp) was found to be 0.3208, 0.5094 and 0.1698 for AA, AB, and BB genotypes respectively and allelic frequencies were 0.5755 and 0.4245 for A and B alleles respectively. The genotypic frequency for cGH2 (1216 bp) was found to be 0.4151 and 0.5849 and CC and CD genotypes respectively, and allelic frequencies were 0.7075 and 0.2925 for C and D alleles respectively. The egg production was significantly (P≤0.05) lower for the birds with BB genotype than those with AB and AA genotypes at cGH1 locus. There were no significant differences between AB and AA genotypes for 40 weeks egg production, probably suggesting the role of A allele at cGH1 locus for higher egg production. There were no significant differences in the 40 weeks egg production among the different genotype at cGH2 locus. The genotypes at cGH2 locus did not effect egg production. 

Key words: Egg production, growth hormone gene, genotype, PCR-RFLP, restriction site


Introduction

Kadaknath is an important indigenous breed of poultry spread over vast area of Western Madhya Pradesh mainly Jhabua and Dhar Districts and adjoining areas of Gujarat and Rajasthan. Due to indiscriminate crossbreeding with the other poultry breeds the pure Kadaknath birds are very rarely available in Dhar Districts and adjoining areas of Gujarat and Rajasthan. At present the Kadaknath birds are mainly available in Jhabua District of Western Madhya Pradesh. This breed has evolved through natural selection in indigenous agro-ecological conditions and is well adapted to local environment. The Kadaknath birds reveal appreciable degree of resistance to diseases than any other exotic breeds of fowl in its natural habitat in free ranging. Kadaknath birds are also resistant to extreme climatic environments like poor housing, poor management and poor feeding (Parmar et al 2003).

 

The chicken growth hormone (cGH), a polypeptide hormone synthesized in and secreted by pituitary gland. The genes of cGH are highly polymorphic which involved in a wide variety of physiological functions such as growth, body composition, egg production, ageing and reproduction (Apa et al 1994) as well as immune responsiveness (Kelley and Felton 1995). Using PCR-RFLP technique, the presence of genetic variants in growth hormone gene can be characterized and association of such alleles with traits of economic importance can be studied. Chicken growth hormone gene has been used as a candidate gene for marker assisted selection for improved performance (Kuhnlein et al 1997). The knowledge of polymorphism can also be useful in phylogenetic analysis. RFLPs have been characterized in the introns of cGH gene of White Leghorn and it has been suggested that the alleles identified were linked to egg production traits, resistance to Marek’s disease and avian leukosis (Kuhnlein et al 1997). PCR-RFLP was also studied in various populations of Chinese native chickens and it was suggested that an allele present in intron1 might be linked to laying performance (Ip et al 2001). The present study was undertaken with the aim to investigate the association of cGH allele with egg production in Kadaknath breed of chicken.

 

Material and method 

Blood collection and DNA isolation

 

53 blood samples unrelated  (pedigreed) hens of Kadaknath chicken with their egg production records were collected from Poultry Breeding Farm Adhartal, Department of Poultry Science, College of Veterinary Science and A. H., Jabalpur. Two ml of venous blood was collected from the wing vein of each bird in EDTA vacuette tubes (Greiner Labortechnik, Austria). The samples were transported in ice and subsequently stored at -35°c. Isolation of Genomic DNA from blood samples was done using the method as described by John et al (1991), with some modifications.  Quality and quantity of DNA was checked using NanoDrop Spectrophotometer (ND-1000). The growth hormone gene polymorphism was conducted using PCR-RFLP method.

 

Chicken Growth Hormone (cGH) gene primers

 

The primers used in the present study, specific to chicken growth hormone gene were synthesized as described by Kuhnlein et al (1997) and Nei et al (2002).

Chicken GH 1 Primer (Forward)    5’ATCCCCAGGCAAACATCCTC3’

                               (Reverse)     5’CCTCGACATCCAGCTCACAT3’

Chicken GH 2 Primer (Forward)    5’CTAAAGGACCTGGAAGAAGG3’

                                    (Reverse)     5’AACTTGTCGTAGGTGGGTCT3’

 

Polymerase Chain Reaction (PCR)

 

Genomic DNA was diluted with autoclaved distilled water to 30ng per μl. Total of 25 μl reaction mixture for both primers was carried out in Mastercycler gradient  (eppendorf). Each reaction volume 25 μl contained primer, both forward and reverse, each 1 μl, PCR Master Mix 12.5 μl, Water 7.5 μl and 3 μl (90 ng) diluted DNA. Except respective primer the    reaction composition was same for both the primer i.e. Chicken GH 1 (Forward and Reverse) and Chicken GH 2 (Forward and Reverse). The reaction mixture was subjected to initial denaturation of  95°C for 4 min followed by 31 cycles of 94°C for 1 minute, annealing at 55°C for 45 seconds (cGH1) while it was 53°C  for 45 seconds (cGH2) and extension at 72°C for 1 minute. Final extension was done for 10 min at 72°C.

 

Restriction enzyme digestion

           

The intron-I of the cGH1 (Forward and Reverse) and intron-IV cGH2 (Forward and Reverse) were amplified using PCR-RFLP method. Restriction digestion was done using

MspI for cGH1 and cGH2.

                                   5’….C ↓ C    G    G….3’

                                   3’….G    G    C ↑ C….5’

 

Agarose gel electrophoresis

 

The PCR products digested with MspI restriction enzyme were analysed on 2.5 % agarose gel (15 µl of PCR product mixed with 1 µl of gel loading dye). The electrophoresis at constant voltage of 80 volt for 45 minutes at 37˚C using 0.5X TBE buffer was conducted. The mass ruler DNA ladder (80 bp) was used for sizing of the DNA bands. The DNA fragments were stained with ethidium bromide (Sambrook and Russel 2000) and photographed using an ultraviolet (UV) transilluminator (BioRad,GelDoc system) to visualize the bands.

 

Statistical analysis

 

Genotypic frequencies of different PCR-RFLP patterns were estimated from the combination of various RFLP alleles generated based on presence or absence of one or more restriction sites. Different genotypes were identified on the basis of different patterns. Gene frequencies were calculated from genotypic frequencies. The allele frequencies were calculated using standard methods. The Chi-square (χ2) test for goodness of fit was used to find out difference among various genotypes and tested for Hardy- Weinberg equilibrium. Genotypes and number of eggs at 40 weeks were analysed by one-way analysis of variance using MSTAT software to find out association of different genotypes with 40 weeks egg production.

 

Results and discussion 

The present study revealed the PCR product of size 770 bp (Figure 1) for cGH1 and 1216 bp (Figure 2) for cGH2, which is similar as reported by Thakur et al (2006) for cGH1 in Kadaknath breed of chicken and Nie et al (2002) for cGH2 in Chinese native breeds of chicken.


Figure 1.  cGH1 PCR product of Kadaknath breed of poultry



Figure 2.  cGH2 PCR product of Kadaknath breed of poultry


Restriction fragment length polymorphism of cGH1

 

The RFLP pattern of cGH1 (770 bp) revealed restriction fragment of 529, 373, 241 and 156 bp size, which indicates two restriction sites.

In the present study the PCR products were digested with MspI. The following three different RFLP patterns were observed (Figure 3).

             (i) 529 and 241 bp

            (ii) 529,373,241 and 156 bp

            (iii) 373, 241 and 156 bp


Figure 3.  MspI digestion of PCR product of cGH1 locus in Kadaknath chicken


The RFLP pattern revealed the restriction fragments of 529, 373, 241 and 156 bp sizes. This indicate the presence of two restriction sites at 373 (site A) and 529 bp (site B) position in 770 bp amplicon. Both the restriction sites are the same as that reported by Thakur et al (2006). With these two sites (373 and 529 bp), there is possibility of ten different restriction patterns. However, in the present study, only following three RFLP patterns were observed.



Thakur at al (2006) studied the PCR-RFLP of intron I of chicken growth hormone gene in three varieties of Kadaknath breed of poultry and reported restriction fragment of 529, 373, 241 and 156 bp sizes digested with restriction endonuclease MspI, which generated 3 different RFLP patterns. Thus, the results reported in the present study for PCR-RFLP of cGH1 in Kadaknath breed of poultry are in agreement as reported by Thakur et al (2006).

 

Restriction fragment length polymorphism (RFLP) of cGH2

 

The RFLP pattern of cGH2 (1216 bp) revealed restriction fragment of 1216 and 608 bp size, which indicates only one restriction site. MspI restriction digestion of cGH2 PCR products revealed two different RFLP patterns (Figure 4).



Figure 4.  MspI digestion of PCR product of cGH2 locus in Kadaknath chicken


The RFLP pattern revealed the restriction fragments of 1216 and 608 bp sizes. This indicated the presence of one restriction site at 608 bp (site C) position in 1216 bp amplicon.



Nei et al (2002) studied the PCR-RFLP of intron 4 of chicken growth hormone gene in 20 Chinese native chicken populations and identified eight restriction digestion profiles using MspI restriction enzyme and confirmed by sequencing. However, no report is available on cGH2 polymorphism in Kadaknath breed of poultry.

 

Gene and genotypic frequencies

 

The gene and genotypic frequencies were calculated by observing the presence of various RFLP patterns for both cGH1 and cGH2 loci and are presented in Table 1. The result indicates that Kadaknath chicken were under genetic equilibrium at cGH1 and cGH2 loci.


Table 1.  Gene and genotypic frequencies obtained at cGH1 and cGH2 loci in Kadaknath chicken

 

No. of birds

Genotypes

Alleles

Chi-square value

cGH1 locus

53

AA

AB

BB

A

B

 

0.3208 (17)

0.5094 (27)

0.1698 (9)

0.5755

0.4245

0.0963NS

cGH2 locus

53

CC

CD

DD

C

D

 

0.4151 (22)

0.5849(31)

0.0 (0)

0.7075

0.2925

1.2148NS

NS-nonsignificant, Figures in parentheses are number of observation


At cGH1 locus, three genotypes were obtained and the frequency of genotype AB was found to be highest (0.5094), followed by AA (0.3208), however, the lowest frequency was observed for genotype BB (0.1698). Genotypic frequencies were tested for equilibrium using chi-square test. The differences among genotypes were found to be non-significant (Table 1), which indicate that population was in Hardy Weinberg equilibrium. Similar findings were also reported by Thakur et al (2006) in three different varieties of Kadaknath breeds of poultry.

 

Based on genotypic frequencies, allelic frequencies were calculated which are presented in Table 1. The allele frequencies were calculated by observing the presence or absence of restriction sites at different alleles. An allele with presence of only one site at 529 bp as 'A' allele and presence of two restriction sites at 529 and 373 bp as 'B' allele. The overall frequencies of A and B alleles were 0.5755 and 0.4245, respectively.

 

At cGH2 locus, two genotypes CC and CD were obtained and the genotypic frequencies for genotype CC and CD was found to be 0.4151 and 0.5849 respectively. The genotype DD was found absent in the Kadaknath birds. Genotypic frequencies were tested for equilibrium using chi-square test. The differences among genotypes were found to be non-significant (Table 1), which indicate that population was in Hardy Weinberg equilibrium.

           

Based on genotypic frequencies, allelic frequencies were calculated at cGH2 locus, which are presented in Table 1. The allele frequencies C and D alleles were found 0.2547 and 0.7453, respectively.          

 

Association with egg production

 

Genotypes and number of eggs at 40 weeks were analysed by one-way analysis of variance using MSTAT software (Table 2).


Table 2. Distribution of means of 40 weeks egg production (numbers) over different genotypes at cGH1   and cGH2 loci in Kadaknath chicken

 

Genotypes/alleles

Mean±SE

cGH1 locus

AA

42.941±0.57a  (17)

AB

41.741±0.45a  (27)

BB

39.889±0.78b  (9)

Overall

41.811±0.35  (53)

cGH2 locus

CC

41.201±1.20NS  (22)

CD

42.176±0.65NS  (31)

DD

0.000±0.00  (0)

Overall

41.771±0.46  (53)

Means carrying different superscripts within a classification differed significantly (P≤0.05 ) from one another. NS-nonsignificant, Figures in parentheses are number of observation


The mean of the 40 weeks egg production (numbers) was significantly (P≤0.05) lower for the birds with BB genotype than those with AB and AA genotypes at cGH1 locus. There were no significant differences between AB and AA genotypes for 40 weeks egg production, probably suggesting the role of A allele at cGH1 locus for higher egg production. The similar egg production in heterozygote (AB genotype) and homozygote (AA genotype) might suggest the complete dominance of A over B allele. Similarly, Kansaku et al (2003) tected polymorphism in Gifujidori inbred strain of chicken at PM1 locus of cGH gene for association with egg production. It was also reported that PS1 allele was closely associated with the production level of egg in Geline strain of chicken. The present finding for cGH1 locus were in close agreement with observations of Kansaku et al (2003).  

 

There were no significant differences in mean of the 40 weeks egg production (numbers) among the different genotype at cGH2 locus. The genotypes at cGH2 locus were independent of egg production (Table 2). 

 

Conclusions 


References
 

Apa R, Lanzone A and Micheli F 1994 Growth hormone induces invitro maturation of follicle and cumulus-enclosed rat oocytes. Molecular and Cellular Endocrinology 106: 207-212

 

Ip S C, Zhang X and Leung F C 2001 Genomic growth hormone gene polymorphisms in native Chinese chickens. Experimental Biology and Medicine 226(5): 458-462

 

John S W, Weitzner G,  Rozen R  and Scriver C R 1991 A rapid procedure for extracting genomic DNA from leukocytes. Nucleic Acids  Research 19 (2): 408

 

Kansaku N, Nakada A, Okabayashi H, Guemene D, Kuhnlein U, Zadworny D and Shimada K 2003 DNA polymorphism in the chicken growth hormone gene: Association with egg production. Animal Science Journal 74: 243-244

 

Kelley S M and Felton D L 1995 Experimental basis for neural immune interactions. Physiological Research 75: 77-106

 

Kuhnlein U, Ni L, Weigend S, Gavora J S and Fairfall W 1997  DNA polymorphism in the chicken growth hormone gene, response to selection for disease resistance and association with egg production. Animal Genetic 28: 116-123

 

Nei Q, Ip S CY, Zhang X,  Leung  F C and Yang G 2002 New variations in intron 4 of growth hormone gene in Chinese native chickens. Journal of Heredity 93 (4): 277-279

 

Parmar S N S,  Shrivastava P N,  Tomar S S,  Pillai P V A and Tomar I S 2003 Characterization of Kadaknath breed of Poultry. Jawaharlal Nehru Krishi Vishwa Vidyalaya Technical Bulletin.

 

Sambrook J and Russell D W 2000 Molecular cloning: A laboratory manual, 3'd edn, 1, 2, 3 Old Spring Harbor, New York.

 

Thakur M  S, Parmar S N S,  Tolenkhomba T C,  Srivastava P N, Joshi C G,  Rank D N,  Solanki J V and Pillai P V A 2006 Growth hormone gene polymorphism in Kadaknath breed of poultry. Indian Journal of Biotechnology 5:189-194



Received 4 April 2009; Accepted 4 May 2009; Published 5 August 2009

Go to top