Leptin gene polymorphisms and beef longissimus muscle association in Hartón Del Valle and Blanco Orejinegro cattle

M Cerón-Muñoz, E Trujillo-Bravo and J D Corrales*

Animal Breeding and Genetics Research Group, College of Agricultural Sciences, and Biology Institute, University of Antioquia, Medellín, Colombia.

*Grica group, University of Antioquia

mceronm@agronica.udea.edu.co
 

Abstract 

The objective of this study was to determine the polymorphisms frequencies for microsatellite BM1500 (ST) and also for an Single Nucleotide Polymorphisms (SNP)  mutation localized in the exon 2 of leptin gene and their association with backfat thickness (FAT) and ribeye area (REA) for Harton del Valle (HV) and Blanco Orejinegro (BON) beef cattle Colombian Creole breeds.

Presence of polymorphisms T and C of SNP was found in both breeds. The T frequency was 0.42 and 0.30 for HV and BON, respectively. Association between SNP genotypes and REA was observed, with higher adjusted means for the TT genotype for BON males, HV males, and HV females. Furthermore, this association between SNP and FAT was also observed in HV. Three alleles were identified in the ST with lengths of 136, 144 and 146 bp. Animals with 146 allele had low FAT levels.

This study indicates that it is possible to develop genetic selection programs using leptin gene markers in Colombian Creole cattle.

Keywords: beef cattle, molecular genetic, meat quality

Introduction

Meat quality, a very important issue for the beef industry, is defined as juiciness, tenderness and flavor (Smith et al 1987, Savell et al 1989, Miller et al 1995) and is related to intramuscular fat or marbling, and backfat thickness (Wheeler et al 1994, Nishimura et al 1999).

Molecular genetic studies have identified genetic markers associated with those traits. Marker frequencies change considerably between breeds and populations. These markers can be used for selecting animals that express superior phenotypes and for the early selection of future breeders. (Stone et al 1996, Lien et al 1997, Wilkins et al 1997, Fitzsimmons et al 1998).

A study conducted in bovine has mapped obese (leptin) gene (Ob) to bovine chromosome 4 (Stone et al 1996, Pomp et al 1997). It is known that Ob determines leptin production (Zhang et al 1994). Leptin, which has been implicated in the control of food intake and body composition in mammals (Hossner 1998, Geary et al 2003), is predominantly secreted by white adipocytes (Zhang et al 1994) and transported to the brain (hypothalamus) through the blood. Leptin has a direct effect on other tissues such as the skeletal muscle (Hossner 1998) where it plays a role in glycogen synthesis and glucose transportation (Margetic et al 2002).

Leptin increases energy expenditure and has a negative feedback inhibiting its own gene expression.  Leptin, which secretion is highly correlated with body fat mass and adipocyte size potentially contributes to animal variation regarding appetite, energy balance and body composition, and is considered as a metabolism modifier (Houseknecht et al 1998). Some studies have reported a correlation between serum leptin and carcass quality in bovines (Wegner et al 2001, Geary et al 2003). Higher leptin mRNA in adipose tissue is associated with increased fat deposition in bovines (Buchanan et al 2002, Kononoff et al 2005). Several regions in the leptin gene sequence are associated with backfat thickness, marbling and rib fat percentage (Fitzsimmons 1999, Hale et al 1999, Buchanan et al 2002).

Several molecular markers have been associated with animal performance and carcass quality. Studying a single nucleotide polymorphism (SNP) associated with carcass fat levels, Buchanan et al (2002) reported that the T allele was associated with fatter carcasses and the C allele with leaner carcasses. Furthermore, Fitzsimmons et al (1998) reported that out of the allelic variants 138, 140, 146, and 149 found in microsatellite BM1500, allele 146 was associated with lower fat levels, while allele 138 was associated with higher levels.

The objective of this study was to determine allelic frequencies of a microsatellite (BM1500) and an Single nucleotide polymorphism (SNP) leptin gene, and their association with backfat thickness and ribeye area in Harton Del Valle and Blanco Oreginegro, two Colombian native Creole breeds of cattle.

Material and methods 

A total of 246 animals from both breeds were used. The Hartón Del Valle (HV) animals, located in Tuluá municipality (Valle del Cauca province) contributed with 74 males and 89 females to the study. The Blanco Orejinegro (BON) animals, located at Cerritos (Risaralda province) and at San José del Nus municipalities (Antioquia province) contributed with 39 males and 44 females. All these animals were fed native grass without any supplements.

Venous blood samples obtained were placed in collection tubes containing EDTA. Extraction of DNA was conducted according to a procedure reported by Miller et al (1988). This method involves salting out of the cellular proteins by dehydration and precipitation with a saturated NaCl solution.

PCR reaction (25 μL) containing PCR buffer (10mM Tris-HCL pH 9,0; 50mM KCl; 0,1 % Triton® X-100), 3mM of MgCl₂; 0,08mM of each dNTP; 5 pmol of forward and reverse primers and 1 U Taq DNA polymerase (MBI Fermentas, Hanover, MD, USA) with 90-100 ng of DNA;  was carried out using a  Thermalcycler  T-Personal 48 (Biometra, Goettingen, Germany).

The sequences for ST microsatellite (BM1500) forward and reverse primers described by Stone et al (1997) were: 5' GATGCAGCAGACCAAGTGG 3' and 5’CCCATTGCTAGAACCCAGG3’, respectively (GenBank Accession # G18586).  Thermal cycling conditions included an initial denaturation at 94°C for 2 min, followed by 29 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 30 s and ending with a final extension for 7 min at 72°C.

The Single Nucleotide Polymorphisms (SNP) consisted in an amino acid change from Cytosine to Thymine (C198T) in the first base position of the 25th codon resulting in an exchange of the Arg for Cys, (GenBank accession # AF120500).  Forward primer: 5´ATGCGCTGTGGACCCCTGTATC3´ and reverse primer: 5´TGGTGTCATCCTGGACCTTCC3´ were used

Cycling conditions consisted of the initial denaturation at 94°C for 2 min, followed by 35 cycles of 94º for 45 s, 61ºC for 45 s, 72º for 55 s, followed by a final extension for 3 min at 72°C.

The ST microsatellite (Stone et al 1997) was submitted to electrophoresis on a 6% polyacrylamide gel followed by silver staining. A digestion reaction consisted of 15ul of PCR product from SNP, 2U of Kpn2I (MBI Fermentas), 10X Y⁺ /Tango buffer and 4mM of spermidine. The final reaction volume of 20uL was incubed to 55ºC during 4 hours. The fragments were visualized by electroforesis on a 3% agarose gel and ethidium bromide.

Body weight and beef measurements in real time

The animals analized by real-time ultrasound were 42 castrated males, 21 males and 80 females from Hartón Del Valle breed, plus 28 Blanco Orejinregro males and 37 Blanco Orejinegro Female, all of them between 16 and 24 months of age. Two ecographic images were taken with an ALOKA SSD-500 equipment using a 12.0 cm, 3.5-MHz linear transductor (Aloka USA, Inc, Wallingford, CT). Images were captured using a PXC-200AL board (CyberOptics semiconductor Corporation, Beaverton, OR) and interpreted using an IA90 CPEC image analyzer (Cattle Performance Enhancement Co, Oakley, KS). To measure the ribeye area and ribeye depth, a first image was taken between the 12^th and 13^th ribs after applying vegetable oil on the animal skin, transversal to the backbone, as described by Stelzleni et al (2002) and Bergen et al 2005. To measure the backfat thickness (FAT), a second image was taken at the level between the last thoracic vertebra and the first lumbar vertebra, parallel to the backbone. (poner imagen de las medidas)

Statistical analysis

Genotipyc and allelic frequencies of the markers,  Hardy-Weinberg equilibrium were estimated in each breed and linkage disequilibrium analysis, using GENEPOP version 4.0 software (Raymond and Rousset 1995).

The effects of marker polymorphisms on body weight (W), ribeye area (REA), ribeye depth 1 and 2 (RD1 and RD2), and FAT were determined by analysis of variance using the GLM procedure of SAS software (SAS Institute Inc, Cary, NC). The mean comparisons were conducted using Tukey and Kramer tests with P≤ 0.05. For the HV breed the following model was used:

For the BON animals, the analysis of variance was conducted separately for each sex, because the males were maintained in a different environment to that of the females.

Results

Presence of T and C alleles of the SNP leptin gene for both native breeds was observed in this study. In both Harton Del Valle (HV) and Blanco Orejinegro (BON) breeds, the T allele was found present with a frequency of 0.42 and 0.30, respectively. While the C allele had a frequency of 0.58 and 0.70 in HV and BON, respectively (Table 1).

The most frequent genotypes for HV and BON were CT and CC, respectively. No Hardy-Weinberg equilibrium was observed in HV, which presented an excess of heterozigotes (P ≤ 0.001), while BON was found in Hardy-Weinberg equilibrium (P = 0.48).

Three alleles were identified in the ST microsatellite. Their lengths were 136, 144 and 146 bp. Alleles 136 and 144 were the most frequent, with 0.40 and 0.48 in HV; and 0.22 and 0.71 in BON, respectively (Table 2). The 136/144 and 144/144 genotypes had the highest frequency in Hartón Del Valle and Blanco Orejinegro, respectively (Table 2).

No association of the SNP and ST genotypes with REA and FAT was observed in FBON. Association between SNP genotypes and REA (P ≤ 0.05), with higher adjusted means in the TT genotype of SNP, was observed in Blanco Orejinegro males (Figure 1).

Body weight trait did not have significant difference for SNP genotypes effect, but TT genotype presented higher (P > 0.05) adjusted means (373.55±17.40 kg) than CT (367.89±12.36 kg) and CC (343.06±32.64 kg).  The ST genotype effect was not associated with REA, FAT or W. 

For the HV population, SNP genotype was significant (P ≤ 0.05). The TT genotype presented higher adjusted means than CT and CC genotypes for REA and than CC genotype for FAT (Figures 2 and 3).

Animals with TT genotype had higher adjusted means for W (361.7 ± 6.6 kg) than CT (359.2 ± 4 kg) and CC (352.4 ±5.3 kg), the SNP was significant (P=0.057) for RD2 with higher adjusted means to TT than CC and CT (6.05±0.17mm, 5.84±0.47 and 5.61±0.09mm, respectively), However, no significant differences were found. For the ST microsatellite, animals with 144/146 genotype had less FAT (figure 4). Age effect, ST by sex, and SNP by sex interaction effects were not significant in this breed.

Model two associates the presence or absence of 146 allele of ST microsatellite with fat levels, according with Fitzimmons et al (1998). ANOVA showed that MBON and HV with the presence of 146 allele had lower FAT with differences significant (P≤ 0.05) (Figures 5 and 6, respectively).

Discussion

In this study, C allele of single nucleotide polymorphisms (SNP) presented major frequencies than T in both breeds (Table 1). This is in agreement with studies in Charolais and Simmental breed (Buchanan et al 2002, Kononoff et al 2005), but disagrees with studies using Angus and Hereford breed (higher T allele). Our results show that Harton del Valle and Blanco Orejinegro breeds resemble late-maturity breeds (Charolais and Simmental), as defined by Bergen et al (1997), and differ from precocious breeds such as the British breeds.

The ST genotype frequencies in both breeds are in agreement with the results by Tessane et al (1999) in Angus breed, who identified the 136 and 144 allele, with 0.49 and 0.51 frequencies, respectively.

Fitzsimmons et al (1998) determined the presence of 138, 140, 146 and 148 allele in Angus, Charolais, Hereford and Simmental breeds. Those alleles were not found in BON or HV breeds, except the 146 allele, which presented 0.07 and 0.12 frequencies in BON and HV, respectively (Table 2).

The Linkage Disequilibrium Analysis showed that SNP and ST microsatellites were linked together (P ≤ 0.05). Therefore, it is possible that both SNP and ST microsatellite are affecting jointly the evaluated trait.

In regard to body weight, MBON and HV animals with TT genotype of SNP were heavier than CC. Nevertheless, Kononoff et al (2005) did not find statistic difference of SNP polymorphism in carcass weight.

Animals with TT genotype presented greater RD2 and REA compared with CT and CC genotypes (P ≤ 0.06), while CT and CC genotypes were similar (Figure 2), indicating that T homozygosis is necessary for a greater expression of the allele.

The association between SNP and FAT in HV breed is in agreement with Buchanan et al (2002) and Kononoff et al (2005), who reported that it is highly probable that T allele is associated with carcass FAT.

 The ST microsatellite presented association with FAT in MBON and HV (figures 5 and 6), which agrees with the research by Fitzsimmons et al (1998) who found association between 146 allele presence and lower FAT levels. Frequency of the 146 allele was higher in HV breed (Table 2). Fitzsimmons et al (1998) also found an association between 138 allele and high FAT thickens in Angus breed. This allele was not found in either of the native breeds researched in our study.

This study indicates that it is possible to develop genetic selection programs for REA and FAT using leptin gene markers. However, more productive and reproductive studies evaluating Colombian native cattle are necessary to confirm the association between this gene and the animal performance in tropical environments.

Acknowledgements

This research was conducted with the financial support of the Extension Vice-Presidency of the University of Antioquia, and by the COLANTA cooperative. Thanks are also expressed to Professor John Brethour (in memoriam).

References 

Bergen R D, McKinnon J J, Christensen D A, Kohle N and Belanger A 1997 Use of real-time ultrasound to evaluate live animal carcass traits in young performance-tested beef bulls. Journal of Animal Science 75:2300-2307 http://jas.fass.org/cgi/reprint/75/9/2300

Bergen R, Miller S P, Mandell B and Robertson W M 2005 Use of live ultrasound, weight and linear measurements to predict carcass composition of young beef bulls. Canadian Journal of Animal Science 85:23–25

Buchanan F C, Fitzsimmons C J, Van A G, Thue T D, Windkelman-Sim D C and Schmutz S M 2002 Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels. Genetics Selection Evolution 34: 105-116

Fitzsimmons C J 1999 An investigation intro leptin’s role as a candidate gene for carcass fat levels in beef cattle. M. Sc. Thesis, University of Saskatchewan, Saskatoon, SK.

Fitzsimmons C J, Schmutz S M, Bergen R D and McKinnon J J 1998 A potential association between the BM1500 microsatellite and fat deposition in beef cattle. Mammalian Genome 9: 432-434

Geary T W, McAdin E L, Macneil M D, Grings E E, Short R E, Fuston R N and Keisler D H 2003 Leptin as a predictor of carcass composition in beef cattle. Journal of Animal Science 81: 1-8 http://jas.fass.org/cgi/reprint/81/1/1

Hale C S, Herring W O, Johnson G S, Shibuya H, Lubahn D B and Keisler D H 1999 Evaluation of the leptin gene as a possible marker of carcass traits in Angus cattle. University of Missouri Beef and Dairy Research Report. pp 25-27

Hossner K L 1998 Cellular, molecular and physiological aspects of leptin: Potential application in animal production. Canadian Journal of Animal Science 78: 463-472

Houseknecht K L, Baile C A, Matteri R L and Spurlock M E 1998 The Biology of Leptin: A Review. Journal of Animal Science 76: 1405-1420 http://jas.fass.org/cgi/reprint/76/5/1405

Kononoff P J, Deobald H M, Stewart E L, Laycock A D and Marquess F L 2005 The effect of a leptin single nucleotide polymorphism on quality grade, yield grade, and carcass weight of beef cattle. Journal of Animal Science 83:927-932 http://jas.fass.org/cgi/reprint/83/4/927

Lien S, Sundvold H, Klungland H and Vage D I 1997 Two novel polymorphisms in the bovine obesity gene (OBS). Animal genetics 28: 245

Margetic S, Gazzola C, Pegg G and Hill R A 2002 Leptin: a review of its peripheral actions and interactions. International Journal of Obesity 26: 1407-1433

http://www.nature.com/ijo/journal/v26/n11/pdf/0802142a.pdf

Miller S A, Dykes D D, Poletsky H F 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 16: 1215 http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=334765&blobtype=pdf

Miller M F, Huffman K L, Gilbert S Y, Hamman L L and Ramsey C B 1995 Retail consumer acceptance of beef tenderized with calcium chloride. Journal of Animal Science 73: 2308-2314 http://jas.fass.org/cgi/reprint/73/8/2308

Nishimura T, Hattori A and Takahashi K 1999 Structural changes in intramuscular connective tissue during the fattening of Japanese black cattle: Effect of marbling on beef tenderization. Journal of Animal Science 77: 93-104 http://www.animal-science.org/cgi/reprint/77/1/93

Pomp D, Zou T, Clutter A C and Barendse W 1997 Rapid communication: Mapping of leptin to bovine chromosome 4 by linkage analysis of a PCR- based polymorphism. Journal of Animal Science 75: 1427 http://jas.fass.org/cgi/reprint/75/5/1427

Raymond M and Rousset F 1995 GENEPOP (Versión 3.3): population genetics software for exact test and ecumenisism. Journal of Heredity 86: 248-249

Savell J W, Knapp R H, Miller M F, Recio H A and Cross H R 1989 Removing excess subcutaneous and internal fat from beef carcasses before chilling. Journal of Animal Science 67: 881 http://jas.fass.org/cgi/reprint/67/4/881

Smith G C, Savell J W, Cross H R, Carpenter Z L, Murphey C E, Davis G W, Abraham H C, Parrish F C and Berry B W 1987 Relationship af USDA quality grades to palatability of cooked beef. Journal of Food Quality 10: 269-286

Stelzleni A M, Perkins T L, Brown A H, Pohlman F W, Jonson Z B and Sandelin B A 2002 Genetic parameter estimates of yearling live animal ultrasonic measurements in Brangus Cattle. Journal of Animal Science 80: 3150-3153 http://jas.fass.org/cgi/reprint/76/10/2542

Stone R T, Kappes S M and Beattie C 1996 The bovine homolog of the obese gene map chromosome 4. Mammalian genome 7: 399-400

Stone R T, Kappes S M and Beattie C 1997 Two polymorphic microsatellites within an 18 kb genomic clone containing the bovine ob gene. Animal Genetics 27 (Supplement 2) pp 64

Tessanne K, Hines H C and Davis M E 1999 Relationships of Polymorphisms in the Bovine Leptin Gene with Differences in Beef Carcass Traits. Research and Reviews: Beef and Sheep. Special Circular.170.

Wegner J, Huff P, Xie C P, Schneider F, Teuscher F, Mire P S, Mir Z, Kazala E C, Weselake R J and Ender K 2001 Relationship of plasma leptin concentration to intramuscular fat content in beef from crossbred Wagyu cattle. Canadian Journal of Animal Science 81: 451-457

Wheeler T L, Cundiff L V and Koch R M 1994 Effect of marbling degree on beef palatability in Bos Taurus and Bos indicus cattle. Journal of Animal Science 72: 3145-3151  http://jas.fass.org/cgi/reprint/72/12/3145

Wilkins R J and Davey H W 1997 A polymorphic microsatellite in the bovine leptin gene. Animal Genetics 28: 376

Zhang Y, Proenca R, Maffel M, Barone M, Leopoldo L and Friedman J M 1994 Positional Cloning of the mouse obese gene and its human homologue. Nature 372: 425-432 http://www.nature.com/nature/journal/v372/n6505/pdf/372425a0.pdf

Received 12 February 2008; Accepted 6 June 2008; Published 3 July 2008

Go to top