Livestock Research for Rural Development 30 (6) 2018 Guide for preparation of papers LRRD Newsletter

Citation of this paper

Effect of nucleotide polymorphism of candidate genes on egg production traits in native Lien Minh chicken

Tran Thi Binh Nguyen, Nguyen Huu Duc, Vu Cong Quy1, Hoang Thi Yen1, Ta Thi Loan2, Dinh Thi Ngoc Thuy2, Vu Thi Tien2 and Nguyen Thi Dieu Thuy2

Faculty of Biotechnolgy, Vietnam National University of Agriculture
1 Department of Science and Technology Hai Phong
2 Institute of Biotechnology (IBT), Vietnam Academy of Science and Technology
ntdthuy@ibt.ac.vn

Abstract

Lien Minh chicken is an indigenous breed with several favorable properties, such as high productivity, good meat quality and it’s association with the economic development of the people in Lien Minh village, near Hai Phong city in Vietnam. Chicken prolactin (PRL5), Vasoactive Intestinal Peptide (VIP), and Vasoactive Intestinal Peptide Receptor 1 (VIPR1) are physiological candidate genes, which might be associated with broodiness and egg production traits. The objective of this study was to investigate single nucleotide polymorphisms (SNPs) of PRL, VIP, and VIPR1 genes concerned with the egg production traits in the Lien Minh chicken. The indexes for 90 hens were observed following individual laying cages, including age at the first egg, the first egg’s weight, the number of eggs, mean eggs’ weight, and eggs’ shape index. Blood samples were used for DNA extraction and then genotyping by the PCR-RFLP method. Five polymorphisms were analyzed including 24 bp indel in promoter region (PRL24), C2402T in 5' flanking region (PRL5), C+338T in VIP, C1715301T (VIPR1/ TaqI) and C1704887T (VIPR1/ Hha I) in VIPR1.

A significant association (p<0.05) was found between polymophic nucleotide at position C1715301T in VIPR1 (VIPR1/ TaqI) with egg numbers (p<0.05) and age at the first egg (p<0.01). Furthermore, chickens carrying genotype TT (VIPR1/TaqI) had the highest egg production with 48.9 eggs/hen/20 laying weeks and the earliest of age at the first egg with 178 days. There was a highly significant relation between VIPR1/HhaI and egg’s shape index (p<0.005). Genotype ID (PRL24) and CT (PRL5) showed higher values of mean weight of eggs 47.6 g and 46.9 g, respectively (p<0.05). This result suggests the potential use of beneficial genotypes for the improvement of the egg production in the selection of Lien Minh chicken.

Key words: association study, Lien Minh chicken, nucleotide polymorphism, reproductive traits


Introduction

Prolactin is a polypeptide hormone secreted by the anterior pituitary gland, which is involved in many physiological pathways; osmotic regulation, luteolysis (regressive ovary), control action, and maintenance of incubation behavior in hens. Studies show that the PRL is present in the hypothalamus, the pituitary gland, the oviduct and the egg, with the highest levels found in the pituitary (Li et al 2009). In chickens, the hormone prolactin plays a very important role in egg production. Prolactin concentrations increase sharply in plasma, may induce broody behavior (Sockman et al 2000) and result in reduced egg production (Reddy et al 2002). A mutation that occurs in the promoter region can affect the expression of the PRL gene, so it may affect egg production. Indel 24-bp at position 358 at the promoter region of PRL gene was significantly associated with egg production in many indigenous breeds (Jiang et al 2005; Cui et al 2006; Begli et al 2010; Yousefi et al 2012; Lotfi et al 2013). The relationship between the substitution of the nucleotide C/ T at position 2402 of the 5'-PRL gene with egg production trait was found in several Chinese, Iranian and Ukrainian chickens (Cui et al 2006; Liang et al 2006; Rashidi 2012; Bagheri et al 2013; Kulibaba 2015).

Prolactin secretion in birds is predominantly regulated by releasing factors, one of which is a vasoactive intestinal peptide (Kagya-Agyemang et al 2012). Vasoactive intestinal peptide (VIP) is a prolactin-releasing factor in birds (El Halwani et al 1990; 1997). VIP increases PRL secretion from pituitary glands, especially when the pituitary gland responsiveness is enhanced with estrogen pre-treatment (Sharp et al. 2005). VIP binds with vasoactive intestinal peptide receptor to give rise to secretion and release of PRL (El Halwani et al 1990). The vasoactive intestinal peptide receptor 1 (VIPR1) belongs to the class II subfamily of the 7-transmembrane G-protein-coupled receptors superfamily (Gaudin et al 1998). The relationship between polymorphism of VIPR and incubation behavior, egg production in avian has been proved in several studies (Rozenboim and El Halawani 1993; Kansaku et al 2001; Chaiseha et al 2004; Xu et al 2011a).

Lien Minh chicken is a native breed of Lien Minh village, Tran Chau commune, Cat Hai district, Haiphong city, Viet Nam. This is a chicken with beautiful features of appearance, nice feather color, yellow skin, good meat quality and thinfat layer under the skin. The source of the Lien Minh chicken gene was assessed at the level of dangerous threat (FAO, 2007), and has been listed on the conservation list since 2008. Since 2013, the conservation and effective use of Lien Minh chicken has been carried out. The production capacity of the Lien Minh chicken eggs is relatively low compared to other native chickens, with an average of 75.6 eggs /hen/ per year (Doan et al 2016). The aim of this study is to investigate the effect of polymorphisms at PRL, VIP, VIPR1 genes on egg production traits in Lien Minh chicken.


Materials and methods

Experimental animals

Experiment was conducted on pure chickens of Lien Minh, which were raised at experimental farm, Center of Applied Science and Technology, Hai Phong in 2016. Total number of 90 hens was individually kept in cages for the period of egg laying from 25 to 44 weeks old. All hens were fed with same diet and veterinary indicators during the experiment. Five egg production traits were evaluated daily during the 20-week spawning period as followed: age at first egg, first egg’s weight, number of eggs, eggs’ weight, and egg’s shape index (D/d).

DNA extraction and PCR amplification

Chicken blood samples from individuals were collected in anti-coaggulant tubes with EDTA and stored at 4oC. Genomic DNA was extracted by a standard procedure using Proteinase K digestion followed by phenol-chloroform extraction and precipitation with ethanol (Ausubel et al 1995). Based on the primer sequences that have been previously published, information for primer pairs and polymorphisms was shown in Table 1.

PCR was performed in a 25 l reaction containing 1x PCR Buffer, 1.5 mM MgCl 2, 1.25 mM each dNTPs, 5 pM primer, 1U Taq-polymerase (Fermentas), and 100 ng genomic DNA. In PCR amplification, an initial denaturation at 94℃ for three minutes followed by 35 cycles of denaturation at 94℃ for 45 seconds, annealing for 45 seconds and extension at 72℃ for 90 seconds, and an additional extension of 72℃ for seven minutes was set. PCR products were digested with restriction enzymes (RE) overnight at 37℃ for all enzymes except TaqI (at 65℃). The restriction fragments were separated on 2.0% agarose gel.

Table 1. Information for primers and polymorphisms

Locus

Polymorphism

Sequence (5’ -3’)

GenBank
accession
number

PCR-RFLP
size (bp)

Ta
(C)

RE

Ref.

PRL

C-2402T (PRL5)

F:FAGAGGCAGCCCAGGCATTTTAC
R:CCTGGGTCTGGTTTGGAAATTG

AB011438

439/304/160/144/81/54

56

Alu I

Cui et al 2006

– 358/ indel 24 bp (PRL24 )

F:TTTAATATTGGTGGGTGAAGAGACA
R:ATGCCACTGATCCTCGAAAACTC

AF288765

154/130

54

-

Au et al 2002

VIP

C+338T

F:GCTTGGACTGATGCGTACTT
R:GTATCACTGCAAATGCTCTG

NC_006090

520/480/40

55

Hinf I

Zhou et al 2010

VIPR1

C1715301T (VIPR1/ TaqI)

F:CTCCTCAGGCAGACCATCATG
R:CTTGCACGTATCCTTGGGTAGC

NC_006089

486/310/176

61

Taq I

Xu et al 2011b

C1704887T VIPR1/ HhaI )

F:CCCCGTTAAACTCAGCAGAC
R:CCCAAAGTCCCACAAGGTAA

NC_006089

434/253/181

61

Hha I

Xu et al 2011b

RE: Restriction enzyme; F: Forward primer; R: Reverse primer; Ta: Annealing temperature; - do not use RE

Statistical analyses

The data was recorded using Excel software, the gene frequencies were calculated by counting method as: p= 2(AA) + (AB) / 2N and q= 2(BB) + (AB) / 2N where p = the gene frequency of allele A, q = the gene frequency of allele B and N = the total number of chickens tested. The Hardy-Weinberg Equilibrium (HWE) was estimated using the method of Rodriguez et al 2009). The association between genotype and egg production was analyzed based on General Linear Model of Minitab software version 16.0:

Yij= + Gi + ξij

where Yij: traits observed; μ: general mean, Gi: influence of genotype; ξij: random error.


Results

Genotypic and allelic frequencies

Figure shows the results of the PCR-RFLP analysis of candidate genes. Bands in gels represented for distinguished genotypes in each polymophism observed, in detail: two genotypes were found at the sites of PRL24 (ID, DD), and PRL5 (CT, TT), three genotypes at the sites of VIPR1/TaqI, VIPR1/ HhaI and VIP (TT, CT, CC).  

For the mutation of insertion/deletion of 24 nucleotides in the PRL gene (PRL24), the PCR product results in two DNA bands with a molecular size of 154 bp (insertion) or 130 bp (deletion), corresponding to I and D alleles, respectively. Locus PRL5 studied contained two cut sites with AluI, but only one polymorphic cut site. Specifically, when the product electrode cut on 2% agarose for two types of cutting with size: 304/ 81/ 54 bp; 160/ 144/ 81/ 54 bp; corresponding to T and C alleles. The SNPs of VIPR1 genes were genotyped after digestion of the PCR products with the restriction enzymes TaqI and HhaI, respectively. The restriction fragment lengths for the T and C alleles of the VIPR1/TaqI locus were 486 and 310/176 bp, and for the C and T alleles of the VIPR1/ HhaI locus, 253/181 bp and 434 bp, respectively. The product of the VIP/ HinfI offers two types of cutting: 520 bp and 480/40bp, which correspond to two T and C alleles (Figure 1).

PRL5/AluI,C2402T
TT: 304 bp/81/54 bp;
TC: 304/160/144/81/54 bp
PRL24
DD: 130 bp; ID: 130/154 bp
VIPR1/HhaI, C1704887T
CT: 434/253/181 bp; CC: 253/181 bp
VIPR1/TaqI, C1715301T
TT: 486 bp;
CT: 486/310/176 bp ;
VIP /HinfI, C338T
TT: 520 bp; CT: 520/480 bp; CC: 480 bp
M: 100-bp DNA ladder
Figure 1. PCR-RFLP analysis of candidate genes

The frequencies of alleles and genotypes of those loci are presented in Table 2. In this study, four single nucleotide polymorphisms (SNPs) and one indel (insertion / deletion) belonging to three candidate genes were identified from Lien Minh chickens. For the PRL24 locus, the number of Lien Minh chickens that had I allele accounted for a low proportion of the population (0.13). A similar trend was found in other loci such as C allele (0.21) (PRL5) or (0.26) (VIP). On the other hand, allele frequencies C for loci VIPR1/TaqI and VIPR1/ HhaI were 0.66 and 0.62, respectively (Table 2). The results also show that the observed distribution of genotypes in three loci (PRL24, VIPR1/TaqI ,VIP) were not significantly different from the distribution expected under the assumption of Hardy Weinberg equilibrium (p>0.05). Genotypic frequencies of PRL5 and VIPR1/ HhaI loci did not follow the Hardy-Weinberg equilibrium (p<0.05 and p<0.001, respectively) (Table 2).

Table 2. Allele and genotype frequencies of genes in Lien Minh chicken (n=90)

Locus

Genotype

Allele

HWE χ2

PRL24

I59724210D

II

ID

DD

I

D

2.63ns

0.00

0.27

0.73

0.13

0.87

PRL5

C2402T

CC

CT

TT

C

T

6.03*

0.00

0.41

0.59

0.21

0.79

VIP

C338T

CC

CT

TT

C

T

0.39ns

0.06

0.41

0.53

0.26

0.74

VIPR1

C1715301T

CC

CT

TT

C

T

2.95ns

0.39

0.53

0.08

0.66

0.34

VIPR1

C1704887T

CC

CT

TT

C

T

28.2**

0.26

0.73

0.01

0.62

0.38

HWE: Hardy-Weinberg Equilibrium, n: number of individuals; *: p<0.05; ns: p>0.05, **: p<0.001

Association of the polymorphisms on egg production traits in Lien Minh chicken

There were significant associations between the VIPR1/Taq I locus and number of eggs in 20 weeks (p<0.005) as TT genotype produced 48.9 eggs, higher than CT and CC genotypes during recorded laying time, respectively. A highly significant association between this polymorphism ( VIPR1/TaqI) and the age at first egg also was found (p<0.005). According to the data, there was a relation between VIPR1/HhaI and eggs’ shape index. The results revealed that the Lien Minh chicken with CT (1.29 0.03) genotype was higher than the CC (1.27 0.02) genotype for eggs’ shape index (p<0.01). Amongst genotypes of the PRL24, ID genotype produced mean egg weight higher than DD genotype (p <0.05), whereas no significant difference was found between the ID, DD genotypes and other egg production traits. A similar trend was found in PRL5, amongst PRL5 genotypes, mean egg weight of CT and TT were significantly different (p<0.05), but other egg production traits of this genotype were not significantly different. There was no statistically significant association in the relation between the SNP of VIP/ HinfI and egg production traits (Table 3).

Table 3. Association between SNPs and egg production traits in Lien Minh chicken (egg/hen/20 laying weeks)

Locus

Genotype

AFE (days)

FEW (g)

EN

MEW (g)

ESI

PRL24

ID
DD

185 8.21a
187 8.25a

42.2 4.57a
39.9 4.98a

45.3 5.77a
43.1 4.73a

47.6 3.11a
45.1 4.33b

1.28 0.03a
1.28 0.03a

PRL5

CT
TT

186 7.99a
187 8.42a

41.2 4.44a
40.1 5.27a

44.9 5.63a
42.8 4.53a

46.9 4.29a
44. 9 3.93b

1.28 0.03a
1.28 0.03a

VIP

CC
CT
TT

182 7.36a
186 7.59a
188 8.69a

40.9 6.98a
41.3 4.02a
39.9 5.38a

47.6 6.58a
44.4 5.44a
42.7 4.43a

45.5 3.16a
46.6 4.24a
45.1 4.18a

1.29 0.04a
1.28 0.03a
1.28 0.03a

VIPR1/ Taq I (C1715301T)

CC
CT
TT

189 7.12a
185 8.29b
178 5.65b

41.5 4.18a
39.9 5.22a
40.4 6.52a

41.9 4.15b
44.3 5.09ab
48.9 5.64a

45.9 4.25a
45.7 4.17a
45.4 4.44a

1.28 0.02a
1.28 0.03a
1.29 0.03a

VIPR1/ Hha I

(C1704887T)

CC
CT
TT*

187 8.71a
186 8.14a
185*

40.2 5.59a
40.6 4.74a
45.5*

45.3 5.96a
43.0 4.56a
53*

46.0 4.08a
45.6 4.25a
48.4*

1.27 0.02a
1.29 0.03b
1.28*

AFE: age at first egg, FEW: first egg’s weight, EN: number of eggs in 20 weeks, MEW: mean eggs weight in 20 weeks, and ESI: eggs’ shape index. a,b values with no common superscripts within a column for each site differ significantly (p<0.05) or highly significantly (p<0.005), *: Data were not subjected for statistical analysis.


Discussion

Egg production trait is one of major interests for breeding in chickens and also a big question for indigenous chickens. To date, several studies have observed the associations of polymorphism in candidate genes on reproduction traits including egg production in chickens. The frequency of allele I of PRL24 appears to be quite different in chicken breeds. In studies on the six Chinese chicken breeds, the frequency of allele I were 0.02 (Taihe Silkies generation F0), 0.05 (Yangshan), 0.17 (Nongdahe), 0.2 (Taihe Silkies F1 generation), 0.22 (White Rock) and 1.00 in White Leghorn chicken - the breed with very high production reaching 300 eggs /hen/ per year (Cui et al 2006). Frequency of allele I was found in Iranian indigenous chickens (0.72), in Mazandaran chicken (0.59), Poltava clay (0.00), Ukrainian chicken, egg - laying Borkovsky Barvysta chickens (0.73), meat–egg - laying chickens (0.14) (Begli et al 2010; Rashidi et al 2012; Kulibaba and Podstreshnyi 2012; 2015). Study of Cui et al (2006) has revealed the effect of indel 24 bp (PRL24) on egg production in an F2 population produced from Nongdahen Taihe Silkies chicken. Analysis of this polymorphism on Ningdu Sanhuang chicken showed that chickens with ID genotype produced a higher number of eggs than those of DD chickens, with 97.3 and 94.0 eggs, respectively (Xu et al 2011b). Age at first laying eggs in chickens carrying ID genotype (191.38 14.09 days) was earlier than that of chickens carrying the DD gene (195.71 16.15 days) (Xu et al 2011a; 2011b). This also shows that the frequencies of alleles I are varied in the breeds of chicken and predominated in the breeds of high egg yield. Data obtained in this study showed the significant difference in mean egg weight in 20 weeks between individual with genotype ID and DD. However, no individual with homozygous genotype II was observed in Lien Minh chicken, the native chicken with relatively low egg production. The lack of genotype II of PRL24 in Lien Minh chicken could be of the genetic structure or limitation of gene resource of breed. Two SNPs at PRL5 and VIPR1/ HhaI loci deviated from the HWE seem likely due to the small sample size or only one population (female) had been used.

Analysis of SNP located in PRL5 locus carried out by Cui et al (2006) showed that high-frequency allele C in Chinese chickens give better egg yields. Also, supportive of this finding, studies on indigenous chickens Zabol Iran, Mazandaran chickens (Iranian) and Azerbaijan chickens, suggest that chickens with CC genotype have better egg production than individuals carrying CT and TT genotypes (Alipanah et al 2011; Rashidi et al 2012; Abdi et al 2014). However, we found no significant relationship between the SNP of PRL5 and egg production parameters tested. The absence effects of this polymorphism on egg production traits in Lien Minh chicken may be due to the differences in genetic nature and appearance of alleles/genotypes in population.

The haplotype analysis based on VIPR1/ HhaI and VIPR1/ TaqI of the VIPR-1 gene validated was demonstrated to have a highly significant effect on chicken egg numbers at 300 days (Xu et al 2011a). This result was in accordance with the previous investigation in different populations (Zhou et al 2008a). On the other hand, other studies proved that the VIPR1/ TaqI locus was significantly associated with duration of broodiness and age at first egg, in which chickens with the CC genotype have longer duration of broodiness and earlier age at first egg than those with the CC genotype (Zhou et al 2008a; 2008b). The SNPs on VIPR1 genes showed a significant association with the egg productivity of Noi chicken in 20 weeks of laying (p<0.05). VIPR1/HhaI polymorphism research on Noi chickens showed that chicken with CC genotype had the highest egg production yield (Nguyen et al 2015). In this study, we found that individuals with the TT genotype of VIPR1/ TaqI have a higher number of eggs than those with the CT/ CC genotypes, and TT genotype also lay the first egg at an earlier age than other genotypes. In addition, there was a relation between VIPR1/HhaI and the eggs’ shape index in Lien Minh chicken. This also implied that two polymorphisms on VIPR1 gene could be considered as DNA markers for the improvement of egg production traits in Lien Minh chicken.


Conclusions


Acknowledgements

This study was funded from a grant of the Science and Technology Cooperation Program (VAST.NDP.01/15-16 - Vietnam Academy of Science and Technology).


References

Abdi M, Seyedabadi H and Gorbani A 2014 Prolactin and NPY Gene Polymorphism and its Associations with Production and Reproductive traits in West-Azarbaijan Native chicken. Bull Env Pharmacol Life Sci, 3(6): 39-45.

Alipanah M, Shojaian K and Bandani H K 2011 The polymorphism of prolactine Gene in Native chicken Zabol region. Journal of Animal and Veterinary Advances, 10(5): 619- 621.

Au W L and Leung F C C 2002 Rapid communication: complete nucleotide sequence of the chicken prolactin gene. J Anim Sci, 80: 138.

Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J D, Smith J A and Struhl K 1995 Short Protocols in Molecular Biology The 3rd ed John Wilet & Sons Inc;

Bagheri S, Tani A S, Niazi A, Zamiri M J and Dadpasand Taromsari M 2013 Polymorphisms of prolactin gene in a native chicken population and its association with egg production. Iranian J Vet Res, 14(2): 113-119.

Begli HE, Zerehdaran S, Hassani S, Abbasi M A and Ahmadi A K 2010 Polymorphism in prolactin and PEPCK-C genes and its association with economic traits in native fowl of Yazd province. Iranian Journal of Biotech, 8:172-177.

Cui J X, Du H L, Liang Y, Deng X M, Li N and Zhang X Q 2006 Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poult Sci, 85: 26-31.

Chaiseha Y O, Youngren M and El Halawani ME 2004 Expression of vasoactive intestinal peptide receptor messenger RNA in the hypothalamus and pituitary throughout the turkey reproductive cycle. Biol Reprod, 70:593–599.

Doan B H, Dang P K, Tuan H A and Thinh N H 2016 Lien Minh chicken breed and live hood of people on Cat Hai Island district Hai Phong city Vietnam: Characterization and prospects.Animal Genestics and Breeding, 209: 26-31.

El Halawani M E, Silsby J L and Mauro L J 1990 Vasoactive intestinal peptide is a hypothalamic prolactin releasing neuropeptide in the turkey (Meleagris gallopavo). Gen Comp Endocrinol, 78: 66–73.

El Halawani M E, Youngren O M and Pitts GR 1997 Vasoactive intestinal peptide as the avian prolactin-releasing factor. Journal of Endocrinology, 403–416.

FAO 2007 The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by B Rischkowsky and D Pilling Rome, (http:// www.fao.org/ docrep/ 010/ a1250e/ a1250e00.htm).

Gaudin P, Maoret J J, Couvineau A, Rouver-Fessard C and Laburthe M 1998 Constitutive activation of the human vasoactive intestinal peptide 1 receptor, a member of the new class II family of G protein-coupled receptors. J Biol Chem, 273: 4990–4996.

Jiang R S, Xu G Y, Zhang X Q and Yang N 2005 Association of polymorphisms for prolactin and prolactin receptor genes with broody traits in chickens. Poult Sci, 84: 839-845.

Kagya-Agyemang J K, Shendan S and Yinzuo B 2012 Studies on the endocrine and neuroendocrine control of broodiness in the Yuehuang Hen. Int J Poult Sci, 11: 488-495.

Kansaku N K, Shimada T, Ohkubo N, Saito T, Suzuki Y, Matsuda Y and Zadworny D 2001 Molecular cloning of chicken vasoactive intestinal polypeptide receptor complementary DNA, tissue distribution and chromosomal localization. Biol Reprod, 64: 1575–1581.

Kulibaba R A 2015 Polymorphism Of Growth Hormone. Growth Hormone Receptor. Prolactin And Prolactin Receptor Genes In Connection With Egg Production In Poltava Clay Chicken. Agricultural Biology, 50:198-207.

Kulibaba R A and Podstreshnyi A P 2012 Prolactin And Growth Hormone Gene Polymorphisms In Chicken Lines Of Ukrainian Selection. Cytology and Genetics, 46: 390-395.

Li H F, Zhu W Q, Chen K W, Zhang T J and Song W T 2009 Association of polymorphisms in the intron 1 of duck prolactin with egg performance. Turk J Vet Anim Sci,33: 193-197.

Liang Y, Cui J, Yang G, Leung FCC and Zhang X 2006 Polymorphism of 5′flanking region of chicken prolactin gene. Domes Anim Endocr, 30: 1-16.

Lotfi E, Zerehdaran S, Ahani M and Dehnavi E 2013 Genetic polymorphism in prolactin gene and its association with reproductive traits in Japanese quail (Coturnix-coturnix japonica ). Poult Sci, 1(1): 29-35.

Nguyen T N, Nguyen H X, Chau T V, Nguyen T A, Tran N D and Nguyen T H N 2015 Effects of genetic polymorphisms on egg production in indigenous Noi chicken. Journal of Experimental Biology and Agricultural Science, 3(4): 487-493.

Rashidi H, Rahimi-Mianji G, Farhadi A and Gholizadeh M 2012 Association of prolactin and prolactin receptor gene polymorphism with economic traits in breeder hens of indigenous chickens of Mazandaran province. Iranian Journal of Biotechnology, 10: 129-135.

Reddy I J, David C G, Sarma P V and Singh K 2002 The possible role of prolactin in laying performance and steroid hormone secretion in domestic hen (Gallus domesticus). Gen Comp Endocr, 2002; 127: 249-255.

Rodriguez S, Gaunt T R and Day I N M 2009 Hardy-Weinberg equilibrium testing of biological ascertainment for Mendelian randomization studies. Am J Epidemiol, 169: 505.

Rozenboim I and El Halawani M E 1993 Chracterization of vasoactive intestinal peptide pituitary membrane receptors in turkey hens during different stages of reproduction. Biol Reprod, 48: 1129–1134.

Sockman K W, Schwabl H and Sharp P J 2000 The role of prolactin in the regulation of clutch size and onset of incubation behavior in the American kestrel. Hormones and Behavior , 38: 168-176.

Xu H, Zeng H, Luo C, Zhang D, Wang Q, Sun L, Yang L, Zhou M, Nie Q and Zhang X 2011a Genetic effects of polymorphisms in candidate genes and the QTL region on chicken age at first egg. BMC Genetics, 12: 33-42.

Xu H, Zeng H, Zhang D, Jia X, Luo C, Fang M, Nie Q and Zhang X 2011b Polymorphisms associated with egg number at 300 days of age in chickens. Genetics and Molecular Research, 10: 2279-2289.

Yousefi S, Raoufi Z, Rasouli Z and Zerehdaran S 2012 Invastigation of prolactin gene polymorphism in Japanese Quail. Anim Sci Biotechnol 2012; 45: 289-292.

Zhou M, Du Y, Nie Q, Liang Y, Luo C, Zeng H and Zhang X 2010 Associations between polymorphisms in the chicken VIP gene egg production and broody traits. Br Poult Sci, 51:195-203.

Zhou M, Lei M, Rao Y, Nie Q, Zeng H, Xia M, Liang F, Zhang D and Zhang X 2008b Polymorphisms of asoactive peptide receptor-1 gene and their genetic effects on broodiness in chickens. Poult Sci, 87: 893-903.

Zhou M, Liang F, Rao Y and Zeng H 2008a Association of twelve polymorphisms of the VIPR-1 gene with chicken early egg production traits. Chinese Journal of Animal and Veterinary Sciences, 39: 1147-1152.


Received 6 April 2018; Accepted 23 April 2018; Published 1 June 2018

Go to top